Your Perfect Assignment is Just a Click Away

We Write Custom Academic Papers

100% Original, Plagiarism Free, Customized to your instructions!


What DNA nucleotides code for the codon UGU?

What DNA nucleotides code for the codon UGU?

What DNA nucleotides code for the codon UGU?

1. If a molecule of mRNA has the following nucleotide base sequences, what will be the amino acid sequence in the polypeptide synthesized by eukaryotic ribosomes? Remember, transcription begins with the start codon AUG.



2. Give the mRNA and then the amino acid sequence for the following base sequence in DNA: TACGGGGGGAGAGGGGGAGGGGGA

3. What DNA nucleotides code for the codon UGU? Identify a base pair substitution that would produce a silent mutation at this codon. Identify a base pair substitution that would result in a missense mutation at this codon. Identify a base-pair substitution that would result in a nonsense mutation at this codon.

Order Solution Now

Our Service Charter

1. Professional & Expert Writers: On Time Essays only hires the best. Our writers are specially selected and recruited, after which they undergo further training to perfect their skills for specialization purposes. Moreover, our writers are holders of masters and Ph.D. degrees. They have impressive academic records, besides being native English speakers.

2. Top Quality Papers: Our customers are always guaranteed papers that exceed their expectations. All our writers have +5 years of experience. This implies that all papers are written by individuals who are experts in their fields. In addition, the quality team reviews all the papers before sending them to the customers.

3. Plagiarism-Free Papers: All papers provided by On Time Essays are written from scratch. Appropriate referencing and citation of key information are followed. Plagiarism checkers are used by the Quality assurance team and our editors just to double-check that there are no instances of plagiarism.

4. Timely Delivery: Time wasted is equivalent to a failed dedication and commitment. On Time Essays is known for timely delivery of any pending customer orders. Customers are well informed of the progress of their papers to ensure they keep track of what the writer is providing before the final draft is sent for grading.

5. Affordable Prices: Our prices are fairly structured to fit all groups. Any customer willing to place their assignments with us can do so at very affordable prices. In addition, our customers enjoy regular discounts and bonuses.

6. 24/7 Customer Support: At On Time Essays, we have put in place a team of experts who answer all customer inquiries promptly. The best part is the ever-availability of the team. Customers can make inquiries anytime.